Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D008F03
Clone ID D008F03
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD008F03
Sequence
ATTTAAAAAGAAAAGAGAAATACATCAAAGCCCCTGCGAATAGGTTTCCGATCGGGTTT
Sequence Type genomic DNA
Unitrap ID UNI19696

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 24852990..24853048 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006715 (Gmnn) NM_020567 geminin Gene [Source:MGI (curated);Acc:Gmnn-001]


SPLK-Sequence tag 3SD008F03
Sequence
GGGCTATAAGTTGTTTATATTTGCATACATNNNGTGAGTGCCAGGGCACAATGTAAATTTTTAATATACATGTAAGTAAG
AGGTGGGGGGTACAGTTTACCGTTCCCCCTAGCCTCCTTT
Sequence Type genomic DNA
Unitrap ID UNI19696

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 24852615..24852732 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006715 (Gmnn) NM_020567 geminin Gene [Source:MGI (curated);Acc:Gmnn-001]

 
Come back to gene ENSMUSG00000006715


For any suggestions or comments, please send an email to unitrap@crg.es