Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D008E07
Clone ID D008E07
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD008E07
Sequence
TAGTGGAAGCTCTGTGAGTCACCTCATCATCCCCTATCAGAAGTCTGGTGGTGTCATAGTTTACATATTCTATAAGGTGA
GGTAAGAGTGCTTGTGAACTGTAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD008E07
Sequence
CCACCTTCCCCCCTGCATTTATCAGGTTTAGTTACCCAGGCATAGTCAGCTCTCCCACCTTCCCCCCTGCATTTTCAGGT
TTAGTTACCCAGGCATGTCAACTGTCACCACTTAGGATTCGTGTTTTCTCTTTGGGTTGGTCTTGGAAGTCTTCCTGCAG
TTTTTTGCTTTAACATAATCTCGTAGTTTACTACCACTAATACGCCTTTCTACTTTATTTCCAAGGTGCATAGTCTGCCT
ACTCTTTACTTTTCTCCAGCAATTGTGTACAGTAACAATTGGAGCTTTTAGGTGATTCTATGAGGTACCCAGAGATCATT
TATTTGAAGAGCATGCCTTTTTTTGGGAGGGCG
Sequence Type genomic DNA
Unitrap ID UNI15223

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41221015..41221366 349
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028433 (Ubap2) NM_026872 ubiquitin-associated protein 2 Gene [Source:MGI (curated);Acc:Ubap2-001]

 
Come back to gene ENSMUSG00000028433


For any suggestions or comments, please send an email to unitrap@crg.es