Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D007H06
Clone ID D007H06
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD007H06
Sequence
GATCACAAAACTGGGAGTAGAGTTAGCATGTCTGTGGGATTTACATTAAAACCCATGTGCTTAGTGTTTCCAGCCTCTTC
CTACTGGATTTGCCTCGTAGTGCGTAGAGAGCCCTGAATCACTGTAAGGACCCCGCACTGCCTTTCCTTCTCTGTTCATT
TGTAGCCGTGTTCGAGTTACTTTACTGGTCCTCCATTAGCTAGCGTTCCTATTGTCTGAGAGGGCAGTCCACACAGGTGA
CAGTGGTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SD007H06
Sequence
AATACATTTGACCTTGCTGTTCAGCACATAAGCTACTGCTTTATGGCATAAGCTCTTTTTGAGATTAGAGTAACTCTACA
CATTGAAAACCTGAGTACTTAAGATAATGGGCGAAGCCACACGCCTGCCTCCGCATTACAACTTGTGTTTACGGCCAAAT
AATGCACAGCACTGTGTAGCTACTGGTAAAAGTGGTTTCCTTCACAGCACCTGTTAAAAAACCCTCATAAACACTACCGA
AACGAGGCAGTAGGCACTAGTGTTTAGCAGCATTAAAAATGAACAAATG
Sequence Type genomic DNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114338116..114338405 274
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es