Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D007E03
Clone ID D007E03
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD007E03
Sequence
GTGTGTATGTGTGCAATGCACACATGGAGGTCAGAAGACTAGGTTCTGAGGATTGATCTACGGTTGTTGGTTTTGGCAAT
AAGTGCTTTTACCT
Sequence Type genomic DNA
Unitrap ID UNI30325

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181001720..181001813 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038705 (Gmeb2) NM_198169 glucocorticoid modulatory element binding protein 2 Gene [Source:MGI (curated);Acc:Gmeb2-001]


SPLK-Sequence tag 3SD007E03
Sequence
GGCCNNGGCTTCTATTTTTGATTGTTTATTTTGGAATAGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038705


For any suggestions or comments, please send an email to unitrap@crg.es