Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D007B05
Clone ID D007B05
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD007B05
Sequence
GATCCCACTGGACAGGTGTATCAACTTTTAGAGGCTGAATGCCATTTTAACATTACATTAAGTAGAATCAGAAAGTCAGC
TGTAGAATGTATTTGCATAATTGGGAAGTTGGGGGTTACAGGATTTGGGATCATGCTAGTTTTGAGATGTTATATATGAA
ATTTTCACTGGTCTAAGAAG
Sequence Type genomic DNA
Unitrap ID UNI943

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 120497159..120497338 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032897 (Nfyc) NM_008692 nuclear transcription factor-Y gamma Gene [Source:MGI (curated);Acc:Nfyc-002]

 
Come back to gene ENSMUSG00000032897


For any suggestions or comments, please send an email to unitrap@crg.es