Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D007A03
Clone ID D007A03
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SD007A03
Sequence
GCTTCTATTTTTGATTGTTTATTTTGGAATAGG
Sequence Type genomic DNA
Unitrap ID UNI30325

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181001664..181001696 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038705 (Gmeb2) NM_198169 glucocorticoid modulatory element binding protein 2 Gene [Source:MGI (curated);Acc:Gmeb2-001]

 
Come back to gene ENSMUSG00000038705


For any suggestions or comments, please send an email to unitrap@crg.es