Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D006H05
Clone ID D006H05
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SD006H05
Sequence
TGGGTGAAGGGGGCCTAAAAGAAAGCAGTGCTAAGTAAAGTATGCTAACATAACGTTTCTGGTCTTAGATTTGGCAAGAT
GACACAGTTTCTGCCTCCCAACCTTCTGGCCCTTTTTGCACCCCGAG
Sequence Type genomic DNA
Unitrap ID UNI11845

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52650127..52650253 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063511 (Snrp70) NM_009224 U1 small nuclear ribonucleoprotein polypeptide A Gene [Source:MGI Symbol;Acc:MGI:98341]

 
Come back to gene ENSMUSG00000063511


For any suggestions or comments, please send an email to unitrap@crg.es