Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D006C01
Clone ID D006C01
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D006C01
Sequence
AGGGCTCTGGCTCTTCGGGTTGGCGCGAGAGTCAAAANNNCTCGCATCGCTTTTGCGCAAGATGGCTGCTGCGGGGNNAT
TCGCGTACTGANNTCTAGCGCGGGGATGGAGACGTGTAGACTGAGTTCGAAACGAAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD006C01
Sequence
GATCCAGCCTCAGCCCTGTGTAGGGCCTGGGCGTTGTCTGGGCGCTCATTGCCTCTTGCCAGTGTTGGTGGCCAGGTGTG
TGTTAATGTAGATTGATCTCAACAGTGACTCTTGAGTAAGAGGCCCTGGGTTTGATTGGGAATGTTGTGTATATTTGATT
TTCCACAAAAGGATGCTCCTTGTTACACTTGTCAGGCAAACTCAGTTGTGTAAGGATGACAAACAGCACACAAAAAAGAT
TGTGTAATTGATGACCCCTGCCAGCACTCATGACCAGCACTTTCCTCCTGCCAATCAGTGCATGTGTAGCATCATAATAG
CTTGTTGAGATCGTGTGCTAGGGGACCTGAGGAGAGCTCAGGTAGGTCTTGAAGGCGAGGTGGGATGTCTTCCTGCCTTC
TGTCGTTCG
Sequence Type genomic DNA
Unitrap ID UNI22601

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180435814..180436222 407
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]


SPLK-Sequence tag 3SD006C01
Sequence
AGCTCTCTGTACCTCTTCTGGTAGGTATTGTCTTAATAGGCTAAAGAGTCTTAATTCAGTCAGTGCTGAGCACCTCAAGT
AATGATTTCTCTTCAGCATATGAGTACTGTCTGTGCCAGGCTGTACACTTCTGTCAGCACAGCATGTTTTACCATGTTAC
ACATCTGCCCTTCGATACTAGGTGACTTCGGTTTAACCCAGAAGAGCAAAGATTCATGTTGCACTTAG
Sequence Type genomic DNA
Unitrap ID UNI22601

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180435563..180435790 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es