Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D005G11
Clone ID D005G11
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D005G11
Sequence
TGTCGCGCTCCTGCAGGGGNNNCCTCAGCTAGGCNNNNCACTGGCGCCCGCGTAGATGGCGAGGAGCCCCCAAGGCCTCC
TGATGCTGCTGCTGCTACACTACTTGATCGTCGCCCTGGCCT
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD005G11
Sequence
TTATCTTTATGTAATGCTTTTTAAAATGTATTCAGTCTATTTCAGTCTAAGAAAATGAAACTCCTTTAAAATACTATCGT
CGTCGT
Sequence Type genomic DNA
Unitrap ID UNI16134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84786107..84786192 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]


SPLK-Sequence tag 3SD005G11
Sequence
ATCTGACAATTTCTCCTAGATTTTCTAAAAGACAGACAATTTGACTGAACCTTTCTTGTCGACCCTCTTCTGATCACAAA
AGAAAAGACTTAGAGAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000053062


For any suggestions or comments, please send an email to unitrap@crg.es