Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D005E12
Clone ID D005E12
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD005E12
Sequence
CGCAACCTTAACGAGTTTTACTCCGAAAGAAGTGGTCCAGTGCCATCCTGTGCTGTTCAGTGATACAGCATATGTTTT
Sequence Type genomic DNA
Unitrap ID UNI6927

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9160823..9160900 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042508 (Dmtf1) NM_011806 cyclin D binding myb-like transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1344415]


SPLK-Sequence tag 3SD005E12
Sequence
ATGTACTGACTTTTATTAATTAGAGCTATATTTTCGTGTTGTAAATAACTTTTGTGGCTTTTAGGCTGTAAATTAAGAAA
GAAAAGACCTTTGATTATATTGAAAGTTTTACAAACATCAAAGGCTATTTTCCTTATAGATTTTCTATTTC
Sequence Type genomic DNA
Unitrap ID UNI6927

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 9160513..9160663 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042508 (Dmtf1) NM_011806 cyclin D binding myb-like transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1344415]

 
Come back to gene ENSMUSG00000042508


For any suggestions or comments, please send an email to unitrap@crg.es