Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D005C10
Clone ID D005C10
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD005C10
Sequence
GATCTTGTGCCTAAAAACAAANNNAAATGAAAAAGGCATGTTCTTAACCTGTAAGCAATACTTAGTGTGATTATGTGTCT
GAGGTGTGTAAATGACCTTAAATTATGTGGCCCCACCACAAATGGCTCTCAGGTTTTGAGTGTTGGTATAAGGCAATATA
AGCAGATGTCCAGTCTCCTTAGTTCTACCTTTCTGTGATATGACTCTTTAAGCTTGCATGGCTGTTTTTGTATTTTCTTG
GTAAAGTATTTGACACAGCTACTGCTCTGTCCCGTTTCCTCCTGCATCAGTGCCTCTGCCTAGAGCTGTGCCACATGGGT
GGTATCTGAATCAACTGCACCTTCCCTTTCAGACTGGTGATGGTGTGAATGATGCTCCTGCTCTGAAGAAATCTGAAATC
GGGATTGCCATGGGCTCAGGGACTGCAGTGGCTAAGACTGCTTCTGAGATGGTCCTGGCAGATGACAACTTCTCCACCAT
TGTGGCTGCTGTTGAGGAGGGGCGAGCCATCTACAACAACATGAAGCAGTTCATCCGCTACCTCATCTCATCCAACGTGG
GGGAAGTGGTCTGGTGGGTGTCTGACTGGAACTAAACAGTATCTTTCAAGGCTGGGGCCAGGGTGTTGAGCTTTCTCAGA
TTGCTGCTTCTGTTAGGACAAATTTGGTTGTTGGCTT
Sequence Type genomic DNA
Unitrap ID UNI30327

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122909881..122910557 671
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029467 (Atp2a2) NP_001103610 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 Gene [Source:MGI Symbol;Acc:MGI:88110]


SPLK-Sequence tag 3SD005C10
Sequence
CCATAGTTCCAAAACTCACTGAGTTTTTTCTCTTCTTCCCTTGGATGGAAACAGTATCTTCCTGACGGCAGCCCTTGGGT
TTCCTGAGGCTTTAATTCCTGTCCAGTTACTCTGGGTCAATCTGGTGACAGATGGTCTGCCTGCCACTGCGCTGGGGTTC
AATCCTCCAGACCTGGACATCATGAACA
Sequence Type genomic DNA
Unitrap ID UNI30327

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122909526..122909713 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029467 (Atp2a2) NP_001103610 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 Gene [Source:MGI Symbol;Acc:MGI:88110]

 
Come back to gene ENSMUSG00000029467


For any suggestions or comments, please send an email to unitrap@crg.es