Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D005B04
Clone ID D005B04
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D005B04
Sequence
GCAAANNNCGNNNNCCCCNNNANNNCGGGCGTTCCCGNNNCAGTCTTTNNNCGGNNNCATGNNNCCTAACTGTGCCCGGT
GCGGCAAGATCGTGNNNCCCACGGAGAAGGTGNNNTGTCTGGATAAGTACTGGCATAAAGCATGCTTTCACTGCGAGACC
TGCAAGATGTCCCTGAACATGAAGAACTACAAGGGTTATGAGAAGAAGCCTTACTGCAANNG
Sequence Type mRNA
Unitrap ID UNI7764

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97661075..97668230 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038366 (Lasp1) NM_010688 LIM and SH3 protein 1 Gene [Source:MGI (curated);Acc:Lasp1-001]


SPLK-Sequence tag 5SD005B04
Sequence
TGTTTTTTAAAAGAAGGTCCCAGCCTGGAAGGGGTAATGTTCCCTGCAAAAATGAGCAGCTGGGCATTCAGGATCAGTGA
GCCTGTCCTTGTTCTGCCCCAGGATACAGCTCCTGTGCACCCTCTCCCTGTCCCTGTCCCTGTCCCGCACACTCCCCCCT
GTCAAGCAATTCATAAAAGTCTTCTTGCCTTAAAGCAGCGTAGCCCAGGCCCTCGGGGTTAGCTTATCTCCTGGGATGGA
GGTTGCTTCTCTTGATTCCTTAGGCCATTGTCCTCGCAAGGGTTTCAAAGGTCGGGCTGGGCTTCAAGGATGAAGGACTT
TGTTTGGCAG
Sequence Type genomic DNA
Unitrap ID UNI7764

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97672730..97673059 330
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038366 (Lasp1) NM_010688 LIM and SH3 protein 1 Gene [Source:MGI (curated);Acc:Lasp1-001]

 
Come back to gene ENSMUSG00000038366


For any suggestions or comments, please send an email to unitrap@crg.es