Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D005A10
Clone ID D005A10
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD005A10
Sequence
GATCTGCCTGCCTATGTATGACTCCTAAGTGCTAGAATTAAAGGTGTATGGGTATGGTNCCACCAGATTGAGTTATATTG
AAAGNNCCCCCGTGNCGGTNTATCTACGGTCCNNNNNNAAANATCCNNNNNNNNNNNNNAGCTCTTGAAGAGACTCTTCT
AAATANCTGTCCTAATGAACGCTCGCGCTGGACACTACTTG
Sequence Type genomic DNA
Unitrap ID UNI30119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106728742..106728820 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040325 (Vprbp) NM_001015507 Vpr (HIV-1) binding protein Gene [Source:MGI Symbol;Acc:MGI:2445220]


SPLK-Sequence tag 3SD005A10
Sequence
TGAGCACAGACCCAGGGTTTTGTGGTGGTAGGCAAATGCTTTATTACAGTAGAGCTGG
Sequence Type genomic DNA
Unitrap ID UNI30119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106728924..106728981 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040325 (Vprbp) NM_001015507 Vpr (HIV-1) binding protein Gene [Source:MGI Symbol;Acc:MGI:2445220]

 
Come back to gene ENSMUSG00000040325


For any suggestions or comments, please send an email to unitrap@crg.es