Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D005A07
Clone ID D005A07
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD005A07
Sequence
GATCTGAAGTTACAGACAGTTGTGAGGCATCACGTGGTGCTGAGAACTGAACTTGTGTCTACTACA
Sequence Type genomic DNA
Unitrap ID UNI6101

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 82326648..82326711 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045103 (Dmd) NM_007868 dystrophin, muscular dystrophy Gene [Source:MGI (curated);Acc:Dmd-001]


SPLK-Sequence tag 3SD005A07
Sequence
CCTTTTAATGGAGTTATTTTACCGCTTTGTAATGCACATGTTAGCAAGAAGCACCTCTCCAGCCCTGCTGGAGTTTTTAG
AAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000045103


For any suggestions or comments, please send an email to unitrap@crg.es