Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D004B03
Clone ID D004B03
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D004B03
Sequence
ACACGNNCCCTGGAAGGCAGGNNNCGGTGGCTGGTGGCCCAGAATGAGGCCAGCTNNNAGCATGCCCTGCAGCCGGACAC
CAACCACTCGGCCTGCAGCAACGGTGATAAGCCAGTCATTCTTCAGGCATCCAGCAAGGAGCCTGGGAGTGGGACCATCA
CGAGCAGTCCCTCCACTGCTCATCCTCAGCTTGCAATTCTACAGACACAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD004B03
Sequence
TGGAGGTGGGAATTGGGAGTTTCCTTCTTGTATCCTAGCCTCCTGAGTGTGCTGGTATTATACCCCTGTACCACCGAGAA
AGCTAGTTCAATTAGTAGTCTTTTCATTTGCTTTTCAATTAATAGTTTTTTCATTGGTCTTTGAAGTTAAGTCCTCATGC
Sequence Type genomic DNA
Unitrap ID UNI14763

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134661307..134661466 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053877 (Srcap) Snf2-related CREBBP activator protein Gene [Source:MGI Symbol;Acc:MGI:2444036]


SPLK-Sequence tag 3SD004B03
Sequence
AAATATGTTTCTAGGTGTTGAGAGCAGGGCTTTGCATGATCCAGGCAAGTAAGCACTCTGCATTGCTCCAATGGATTTGA
TTCTTAGTTTTTCTTAGCTAATTGGAAATTTTGATACATAGTTTTTAGTCATTTAGCTGGGGTAGGAATTTGAGGCATAT
TGAGGCTTTATTATTGTACTGGATTTCATGAGTGAGCTCATTTGTCATATTTCAGTGGGACACTGTTTTCCAGTTACTGC
TTTTATAGTTGATATTTTGTAAAG
Sequence Type genomic DNA
Unitrap ID UNI14763

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134661516..134661779 264
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053877 (Srcap) Snf2-related CREBBP activator protein Gene [Source:MGI Symbol;Acc:MGI:2444036]

 
Come back to gene ENSMUSG00000053877


For any suggestions or comments, please send an email to unitrap@crg.es