Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D004A04
Clone ID D004A04
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D004A04
Sequence
CCNCACGCAAAACATAACCCACCTCAACCACCCCCACCATCAACCCACACNACCNNCCAACCNNACACTCCAATAACCAC
AACCCCAAACACACCCCCACCCAACCNCAACNNCCAACATCCCAAAAGACANNAACAACNNTGCATAAGGCCAGCGTCCC
ATGAAAAAAGCAACACACCTAATACATATCNNNCCGCAGCAAACGAACCCGGCGNNCGGATCGGCGGGNAATAGCGTTNN
GGTCCTTAGGGGACTCNNCAATNNNCTATTCGCGGNNNAACTAGAAGCGGTGGGNNNCTCCTCGGCGGGAGGGGGGGTGG
TGATNNNGGNNNTGAANNNGCAGGTGTGATTNNNTTCAGTACAGCACGGCCCCGTGGAAGTGCAGAGTCTCACAGGGGGG
GTGGTCTCTGCTGACACAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134655686..134657754 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053877 (Srcap) Snf2-related CREBBP activator protein Gene [Source:MGI Symbol;Acc:MGI:2444036]


SPLK-Sequence tag 5SD004A04
Sequence
GATCTTACTTTGTGTTTGAGGCTGGTCTCTAATGCCTATGTTAAAACAATCATCTCCAATGTCCCAAATAGCTGTGAATA
TTGGCATATACAGATATCAAGATATGTCTGTCTAAGCAAGTTCTTACAGGTATTTGATACAGAGTAAGTATCTAAGACAT
AGGG
Sequence Type genomic DNA
Unitrap ID UNI14764

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134658868..134659031 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053877 (Srcap) Snf2-related CREBBP activator protein Gene [Source:MGI Symbol;Acc:MGI:2444036]


SPLK-Sequence tag 3SD004A04
Sequence
TTATCCAACTGCAGGTACTCCAGAGGCTGGTGAACCTGAGCGGAGGCTGGGACGCCCTGGNNNGCCCCGGGCCCTGAAAG
GCAGGTCCCGGTGGCTGGNGGCCCAGAATGAGGCCAGCTCCCAGCATGCCCTGCAGCCGGACACCAGCCACTCGGCCTGC
AGCAACGGTGATAACCCAGTCATTCTTCAGGCATCCAGCAAGGAGCCTGGGAGGGGGACCATGCAGAGCAGCCCCTCCAC
TGCTCATCCTCAGCTCCCAATCCTACAGACACAGGTTTGAANGGGGGGAAGGGNCCCTATGNNTATTTCCATGAACNNAT
NNCTGCCTTTGAAANNNNGTGATGTTGCAGGTCTTCCTTACCCCCCTAAGTTTAAAACTCCCTTTAGTTCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000053877


For any suggestions or comments, please send an email to unitrap@crg.es