Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D004A01
Clone ID D004A01
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD004A01
Sequence
GATCTTCCCTCAAGGACAGCCTGTGCAGAACCTGCTCTTGGACAGCCATGGGGTGAGTGGGCCATGGAGTGAATTTGACC
ACTTTGACTGTCAACAAGCCAGCTTTTCTGTCCCTTGCCAAAGCAAGATGGAAAGTTACAGAGCCCTGGCTTCTGACCAT
AAAAAGGATATGTGGCAGAACTTGTCAGGGGTGCCCTGGGATGACTAGTGAGCATGTGAGGCTAGTATGACAGTGTCCCG
GTGCCTGTGTCTCCCTCTCACTCTTCATGTTTGGCTGTGTAGGGACTGTTGTATGCCTCCTCCCATTCCGGGGTGGTGCA
AGTGCCCGTAGCCAACTGCAGCCTGTACCCAACCTGTGGAGACTGCCTCCTGGCTCGAGACCCCTACTGCGCCTGGACTG
GCTCTGCCTGCAGG
Sequence Type genomic DNA
Unitrap ID UNI11284

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87365392..87365805 414
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030539 (Sema4b) NM_013659 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B Gene [Source:MGI (curated);Acc:Sema4b-001]


SPLK-Sequence tag 3SD004A01
Sequence
AGACCATTAAAAAGTATGGTAACTTTATAAGTAGAGATGTCTACTGTGAAAATAGCCCTGTGCTATTTGGCACAGTTATG
CACACCTTTAATCCTAGCAAGCAGGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000030539


For any suggestions or comments, please send an email to unitrap@crg.es