Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D003G03
Clone ID D003G03
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD003G03
Sequence
GATCTCATGAGTCCTTGCCTTTCCTTTGCGTTCTGCTTTTCGCGAACAAGCTATTTTAAGCGAGTCTGTAAGCATTTAAA
GGGTTATCTATGGGCCTAAGCGCCTCCGATTTGTAAGGAGTATTGAGGATTTGCGAGCTGGACTTTAATTTGTTGGGGCT
AAATACACCCAGTGTGTGCAGCGATTTACCCCACCTTTCCTTGTCTCCATATAGAAC
Sequence Type genomic DNA
Unitrap ID UNI443

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 72076236..72076453 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060073 (Psma3) NM_011184 proteasome (prosome, macropain) subunit, alpha type 3 Gene [Source:MGI Symbol;Acc:MGI:104883]


SPLK-Sequence tag 3SD003G03
Sequence
TATTTGCAGTAGAGGTAATGAATGAATAATGCGTTTCTTGGTTATCCTTGTTTCCCCCATTATTTTGATGCTC
Sequence Type genomic DNA
Unitrap ID UNI443

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 72076471..72076543 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060073 (Psma3) NM_011184 proteasome (prosome, macropain) subunit, alpha type 3 Gene [Source:MGI Symbol;Acc:MGI:104883]

 
Come back to gene ENSMUSG00000060073


For any suggestions or comments, please send an email to unitrap@crg.es