Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D003E04
Clone ID D003E04
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D003E04
Sequence
CTCCTTANNNNCCCCTGCCCTCCGAGAGGAGAAGGCACCTTGAGAGGAGAAGTACTGTGATCGGAGAGGAGAAGGCCGCG
AGAAACAAGAGCAGGCTTCTGGTCTGTGGCAGGCAAGAGAATTCTGCCCCTGAGGCATGGCCGGAAGACAGAACTAGCTG
AGTGCTTCAGTCTGCAGAAGTCTTTCAGGATTCAGCTGAGGTGGGCCTCAGTCGGCAGACAAGATGCTCCTGGCTCTGGG
ACTCACGCTGGTGCTCTATGCAAGCCTCCAGGCTGAGGAAAACT
Sequence Type mRNA
Unitrap ID UNI10799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106576216..106585724 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]


SPLK-Sequence tag 5SD003E04
Sequence
ACTGCTGACAACTGTGGGTTGAGTAACTAACGGCCCTTCCCACAGCAGAGCTGGCCTGTGGCCGCTCATTTCCTGGTAAG
AGGTCAAATCTTGAGAATGTCTCACTGGGTCGTTTCTGAATTTCTCTATTTTATG
Sequence Type genomic DNA
Unitrap ID UNI10799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106566115..106566249 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]


SPLK-Sequence tag 3SD003E04
Sequence
TAATTTCATCATTTCCCTGTTTATATTCATATAACCTCTTGGAGGACATAAACCCATGAAACCTTCACAAAGAAGCAAAC
AGGGCATGAACAGCCATCTCTGCTTTGAGAAGTTGGTACATGTGGAACCTCCAGTTAGATGCTCTATTTACACAACAACA
AAACCCAACCCCACCCCGAGAGGGGGGCTCATTATATAGCCAATCTGACCTTCGACTTCTCCCACTGAGCCCTGGCCTTG
GCTTTATG
Sequence Type genomic DNA
Unitrap ID UNI10799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106565834..106566081 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es