Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D003C01
Clone ID D003C01
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD003C01
Sequence
GATCCGGCCTGGTTTTGGGGGCGGAGGGGGGGTGGCGATGGGGTGGAGCTGCCCCAAACTCCCCCNNNNGTGGCCCTCGG
TTTGGAGTGCGGAGGATTAATTTGTTCCGGGTGGGAGGTAGAGAAGCGAATGGCCCCATGGGCTCTAGATGTGGCGCGGA
GGGGGGTGAGTCTCCCATCCTCCGCGCGTGGGCTTCTGTCCTCTCTGTTCATTTCCAGCCTCTTTGTCAGCTCCTCTTAT
TACCCTGCCTTCTTTCTTACCGACCCTGGTCGTGGAATATATTTTCGCTGCAGTCTTTGACTTCCTGTTGTCTATACTGT
AGTTTTGGCT
Sequence Type genomic DNA
Unitrap ID UNI18328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89855546..89855873 318
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042520 (Ubap2l) NM_028475 ubiquitin associated protein 2-like Gene [Source:MGI Symbol;Acc:MGI:1921633]


SPLK-Sequence tag 3SD003C01
Sequence
TGGAATACCAAATTTCTTGAGACCCTTCACCTGGTGGACAGCCCCTAAATTGTTTTGCAAAGTGATGTCACAAACAAGAG
ACTGTTTTCCACGATTCTTAAAATTTAGCAACCTCTGGNNAAGAATGTTGTGGAAAGAAAAAACAGTTAAAGGCGATTTT
GTTAAATTTGTTTTTGCCTTTGACTCACTGACTACTAAATGGAGAGATTATTTTTTGTCTCCACCTCCCATATTCTGCGT
TGGGGATATCTGCTGTGTCTTGCTGGGAGGGGGGTATGAGTCAGTTTGACAACCAGCATTAGAGATTAAAATATTTGGAT
GTGTATCTGTTGATAAGACTGTGTTGTGGG
Sequence Type genomic DNA
Unitrap ID UNI18328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89855084..89855433 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042520 (Ubap2l) NM_028475 ubiquitin associated protein 2-like Gene [Source:MGI Symbol;Acc:MGI:1921633]

 
Come back to gene ENSMUSG00000042520


For any suggestions or comments, please send an email to unitrap@crg.es