Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D001H01
Clone ID D001H01
Vector rFlpROSAbetageo
Project ggtc

Sequence tag D001H01
Sequence
AGACCGANNATAGNNCTCCCTAACCCTNNNCGGAACAGAGTTCGTCCTTCTAAAAAGGGAGGGGTCCAAGGAGCTGAACT
CCTAGCCGCCTAGATTTCCACTGTGGCTCTGGGTACGAGTGGCAGTTTCTTCTTGGGATTTCAGAAAGGAAGCCAAGGAG
GAAATAGAGCGCGCTGCATCGCTGTGGGCATTAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SD001H01
Sequence
GATCCCTGTCTCGAAAAACCAAAGCGGGGAAAGATCGACTGCTTCTGTGGTGACTATGGCTTCCTCCTGTAGTAAATATG
ACGGCCTTCTGTAGTAACTTCGGCTTCTTTCCCTACTTAAAACTTTTATCCTAGGT
Sequence Type genomic DNA
Unitrap ID UNI11663

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44390947..44391082 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051176 (Zfp42) NM_009556 zinc finger protein 42 Gene [Source:MGI Symbol;Acc:MGI:99187]

 
Come back to gene ENSMUSG00000051176


For any suggestions or comments, please send an email to unitrap@crg.es