Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone D001C03
Clone ID D001C03
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SD001C03
Sequence
CACCGAATTTAGTACGCAGACGATAGTCTACCTCACAGAGATTCACCCAGATTAATTTAAATATAACTGATAGCTTTTTG
GCTCTTAGGCCTTCAGACTCTGACTTTTTAAGTTCTAAGGGAACTGATGGCTCT
Sequence Type genomic DNA
Unitrap ID UNI29634

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 126499881..126500014 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027361 (Gabpb1) NM_207669 GA repeat binding protein, beta 1 Gene [Source:MGI (curated);Acc:Gabpb1-003]


SPLK-Sequence tag 3SD001C03
Sequence
TGTATATTATGCTTTTTTTAAAAAACATGATATATCCCATCCTTCTATTCAGCATGTTAAGTACAATCAAGATATTGTGA
AAGACAAACTGAATGAGAAGAATGATTCTTGTAGTTTGGGGGAGAGGCCTCTAACTTTTTAAAAGATGGCCATTTAGATG
CTTAAGCATTGCAGAGATTATAATTTACCAGTAGCCTTGATATCTGGAAATAGTCCAAGTGACAAGACATTTTAAAGTTC
CAGTTCATATGCTTAACGATGTACACATATAATCAGCGTGTAAAGACCCGCTTGTAAGTACCTTCTTCACGAGGACACGT
GCATCTTAGGCGCTTCAGACTTCCGTGGGAAGTGAGGTGTTTGCCGAAACAAAATGCACATGTAGTTTGCATGTGTAAGT
CTTAGCCTCTTCCCTGACTCAGTCTGGGTTTCTTGGGTGTGGGCGATTAATCTGTAATAGTTCAAGATGAGTTTNNNGCT
AATGGCTTTGGAAGGAAGCTGAGTTTCCAGTGGTTTCTTAAAACCCTCGTCTGATTCTGTCAGTTGACCTCTGCTGTTTC
ATCAACAGGAAGCATCTGGCCATTCTTCATGTCATTGTCAGAAAGTGCCNNNNGNNTTNNTTATGGTTGCTATTATGCAT
ATCAAAATT
Sequence Type genomic DNA
Unitrap ID UNI29634

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 126499042..126499689 623
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027361 (Gabpb1) NM_207669 GA repeat binding protein, beta 1 Gene [Source:MGI (curated);Acc:Gabpb1-003]

 
Come back to gene ENSMUSG00000027361


For any suggestions or comments, please send an email to unitrap@crg.es