Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_418H8-3
Clone ID CMHD-GT_418H8-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_418H8-3
Sequence
GCCAAAGTGAACAACTCTAGCCTGATTGGCTTAGGGTACACTCAGACCCTAAAACCAGGTATCAAACTGACGTTGTCAGC
CCTGCTCGATGGCAAGAACGTCAATGCGGGTGGCCACAAGCTTGGCCTAGGACTGGAATTTCAAGCATAAATGAATATTG
TACAATCGTTTAATTTTAAACTATTTTGCAGCATAGCTACCTTCAGAATTTAGTGTACCTTTTAATGTTGTATGTTGGGG
ATGCGAGAGTTGATAAATACCACGTTAGACCTCCAGGCTAAGGATGACTCGGCTTTAAGGTGTTTACCATTTCAGAGGTA
CAGCATAAACCCCATTCCAGAAAGGGTCCTTTTTAACTGTAGACGTGGGTTGGGGAGGAGCCCCTGTATAGATGCCAGGC
TACAAGTGGAAAGCTGGGAACATGTGGATCCTTTGTAAATCTGTATCCAGTCCCCAAATGAAATTGTGACTTCCCGAGCA
TCAAACCCTGGTGTCCACATCCTATCTGCTCGGAAGCATGTACACACCTGCGTGAAAGGGATGTTTTTAGACTGATCCTC
ACACCCTGTTCCCATCGTGCCCTGTTCCCATCCTAGCCCATCACTTAACCTGTTTTACACCAAAAGTAGTCTTTAGGGTG
TGGTTAGCTATTTCTTTTGTGCCATTTTAGGGTGGAGAGGGTGGGCGTGATGGAGCCAGTCATTCAGGACTTAATTCTTC
CTTGTGTTGTGGTGTGGTTTTCTTTCTTCTTCTTCTTTTTTTTTTTA
Sequence Type mRNA
Unitrap ID UNI2245

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52200918..52202641 695
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020402 (Vdac1) NM_011694 voltage-dependent anion channel 1 Gene [Source:MGI (curated);Acc:Vdac1-001]

 
Come back to gene ENSMUSG00000020402


For any suggestions or comments, please send an email to unitrap@crg.es