Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_419B8-3
Clone ID CMHD-GT_419B8-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_419B8-3
Sequence
AGGACACTTCGCCGAGTTGCTGAGTTACTGGCAGTTTGTAGGCAAAGACAAAGGTGCCATGGCGACCGAGTACTCTGCGT
TGTTACCACTGCTTAAAAA
Sequence Type mRNA
Unitrap ID UNI30334

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103938036..103938115 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032558 (Acad11) NM_175324 nephronophthisis 3 (adolescent) Gene [Source:MGI (curated);Acc:Nphp3-001]

 
Come back to gene ENSMUSG00000032558


For any suggestions or comments, please send an email to unitrap@crg.es