Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_418A3-3
Clone ID CMHD-GT_418A3-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_418A3-3
Sequence
GTGGGGTCTTTCATACCTCAGTGAAGATGCACTAGACTGTGAGATCGTGAGCGCGAAGTCGTCCGAGATGAATGTCCTGG
TCCCTCAGGATGACGATTATAGAGAATTCCCCATTCCCGAGCAGTTCAAGACAATATGGGATGGCTCCAAGCTGGTCACC
GAACCTGCAGAGATCATGGCCTGACATCCAAGAAATAGCCTTCCCTGAGTCTCCTCTAGCGAACAGAAGCAAGCAGCTAA
TAGGAGCTAGATTTTACCATAGCCCCGACGCCCGTGTCCGTGTCCGAATCCTGCAGTTCTGTGCCATGGAAAACAGTATC
TTTTCTGGCAGGCTTTTATGGGCGTTTTGAAATATTTAACATTTGATCATC
Sequence Type mRNA
Unitrap ID UNI13036

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 46741949..46743919 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021373 (Cap2) NM_026056 CAP, adenylate cyclase-associated protein, 2 (yeast) Gene [Source:MGI (curated);Acc:Cap2-001]

 
Come back to gene ENSMUSG00000021373


For any suggestions or comments, please send an email to unitrap@crg.es