Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone F019B08
Clone ID F019B08
Vector pT1betageo
Project ggtc

Sequence tag F019B08
Sequence
CAGACAGCTCTTGCAGGTTATTCAAGAAAAAGAAAAGAAAGGAAAAGAAAATGATATGGAAATGGAAATCAAATGGGTTC
CAG
Sequence Type mRNA
Unitrap ID UNI10503

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 139974489..139974571 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045624 (Esf1) NM_001081090 ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Esf1-001]

 
Come back to gene ENSMUSG00000045624


For any suggestions or comments, please send an email to unitrap@crg.es