Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_434E3-3
Clone ID CMHD-GT_434E3-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_434E3-3
Sequence
GAGAATGGCAAGAATGAAGAGATTCTGAATTCCCTCAAGTACGTCCGACCTGGTGGCGGGTTCGAGCCCAATTTTACATT
GTTTGAGAAGTGCGAAGTGAATGGTGAGAAGGCTCACCCGCTCTTTACCTTCCTGCGGAATGCCTTGCCAACACCCAGTG
ACGACCCCACTGCGCTCATGACCGACCCCAAGTACATCATTTGGTCTCCGGTGTGCCGCAACGACATTGCCTGGAACTTT
GAGAAGTTCCTGGTGGGCCCCGACGGTGTTCCCGTGCGCAGGTACAGCCGCCGCTTTCGTACCATCGACATCGAACCTGA
CATAGAAACCCTGCTGTCCCAGCAGTCTGGCAACTCCTAAGGCGGCCCTGGCATTGGCTTGGTGATTACTGGCTGCACTC
TGGGGGGCGGTTCTTCCATGATGGTGTTTCCTCTAAATTTGCACGGAGAAACACCTGATTTCCAGGAAAATCCCCTCAGA
TGGGCGCTGGTCCCATCCATTCCCGATGCCTTTCCACCTAATGAAAGGTGGTTTCACTACTAAGAATAAAGTGCTGAATA
TC
Sequence Type mRNA
Unitrap ID UNI12653

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108242108..108242669 562
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063856 (Gpx1) NM_008160 glutathione peroxidase 1 Gene [Source:MGI Symbol;Acc:MGI:104887]

 
Come back to gene ENSMUSG00000063856


For any suggestions or comments, please send an email to unitrap@crg.es