Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_438C9-3
Clone ID CMHD-GT_438C9-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_438C9-3
Sequence
CTCATCCAAACACACAATGAAGATGTTTTGGAGTATAAAAGAAGAAATGGATTGGAATAAACTTTGGAAATAATACAGTC
AGCTTCATGTGATGATCACAGTCCTTCCTCTGGATTCACCCTCAGTGACGGATGTGAGAAAAGAGTTACATGCGAATATG
AGTCAGTCAACACGTTTTGCATGGTTAAGTTAAAGAAATAAAAATACTCGCGCTCCTCATGTGTAGACAG
Sequence Type mRNA
Unitrap ID UNI18141

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51209391..51211334 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037152 (Ndufc1) NM_025523 NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 1 Gene [Source:MGI (curated);Acc:Ndufc1-001]

 
Come back to gene ENSMUSG00000037152


For any suggestions or comments, please send an email to unitrap@crg.es