Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_434H4-3
Clone ID CMHD-GT_434H4-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_434H4-3
Sequence
GCTCCTCCTACTGCTAGAATCGGCTCTTCACCCAAAGCGTCACTGCTACACGTTTTCAGAGGACATTGAGTCCCCACCCC
TCTTTCTTGACCGGAACCAGCTCCTACAGTGGTCCATCAAGGCCCCTGTCTAGTTTGCAAGAAGTTATGCTTTGCTGAGT
TTTGTCTACCTCCTGAAGTAGAGTTGTAAGACCCCACTCCCCCCAGCCTCCGGGCCCAGACTCTGAAATAAAGATACAAA
CAACAAGGCCTCC
Sequence Type mRNA
Unitrap ID UNI14077

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 112066288..112066540 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031727 (Pmfbp1) NM_019938 polyamine modulated factor 1 binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1930136]

 
Come back to gene ENSMUSG00000031727


For any suggestions or comments, please send an email to unitrap@crg.es