Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_434D7-3
Clone ID CMHD-GT_434D7-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_434D7-3
Sequence
TGTGGCTTTTTCAAAAGAAAATATCAACAACTGAACTTGGAGAGGACACGGAGGGTTAAGCTGAAGGCTGACAGTCTGCT
CCAAGATTAGCCCCCTGCTTCCTCACCGGAAGGAGGGAGTTTGAGCCAGTCGGAAGCCGGGATGCCCCCTATCGGGGCCC
CTTACTCTCCTTAGGACGATCAAGCAACATCAAAGAACTGTAGAGTGTTGTTCATAGCCACACACTATGCCCACAGTGTC
TTGTGAATTGAGCAAAAGGGAAACTTAGGATGTGTGCTATTAAATACATTTACTTTTACAGCAGTGCCTTTAATGAACAC
GGTTCCCAGTTTGCCATGCGTTTTGATGACTGATAGACCAAAGTCTTATTCCTATTAAAATATTAATTATATCATT
Sequence Type mRNA
Unitrap ID UNI14138

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 72960553..72960948 384
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005947 (Itgae) NM_008399 integrin alpha E, epithelial-associated Gene [Source:MGI (curated);Acc:Itgae-001]

 
Come back to gene ENSMUSG00000005947


For any suggestions or comments, please send an email to unitrap@crg.es