Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_403F11-3
Clone ID CMHD-GT_403F11-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_403F11-3
Sequence
TAGATGCCATTGACCCCACCAGGAAGCAGAAGGTAGAAGCTCAGAAACAGGCGGAAAAACTGATGAAGCAAATTGGTGTG
AAAAATGTGAAGCTTTCAGAATATGAAATGAGTATTGCTGCTCATCTAGTAGACCCTCTTAATATGCATGTTACTTGGAG
TGATATAGCAGGTTTAGATGACGTCATTACAGATCTGAAAGACACAGTCATCTTACCTATCAAAAAGAAGCATTTGTTTG
AGAATTCCAGACTACTGCAGCCTCCAAAAGGTGTTCTTCTGTATGGACCTCCAGGCTGTGGGAAAACATTAATTGCCAAA
ACAACAACCAAAGAAGCAGGCTGTCGGTTCATTAACCTCCAGCCTTCAACACTGACTGATAAGTGGTATGGAGAATCTCA
AAAACTGGCTGCTGCTGTTTTCTCCCTTGCCATAAAGCTACAGCCTTCTATCATATTTATTGATGAAATAGACTCTTTCC
TACGAAATCGTTCCAGTTCTGACCACGAAGCTACAGCGATGATGAAAGCTCAGTTTATGAGTCTCTGGGATGGACTGGAC
ACTGATCACAGCTGCCAGGTTATAGTAATGGGAGCTACCAATCGCCCTCAAGACCTTGACTCCGCTATAATGCGAAGAAT
GCCTACACGATTTCCTATTAACCAGCCTGCTCTAAAACAAAGAGAAGCAATTTTAAAGCTCATCTTG
Sequence Type mRNA
Unitrap ID UNI15835

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32758504..32781374 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013662 (Atad1) NM_026487 ATPase family, AAA domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1915229]

 
Come back to gene ENSMUSG00000013662


For any suggestions or comments, please send an email to unitrap@crg.es