Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_413C12-3
Clone ID CMHD-GT_413C12-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_413C12-3
Sequence
GAAATGGACCTCACCATGACCGTTGCTGCACATATAATGAGGACAACTTGGTGGATGGTGTTTATTGTCTCCCAGTAGGA
CACTGGATTGAGGCCACTGGGCACACC
Sequence Type mRNA
Unitrap ID UNI29438

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 11110609..11110715 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055493 (Epm2a) NM_010146 epilepsy, progressive myoclonic epilepsy, type 2 gene alpha Gene [Source:MGI Symbol;Acc:MGI:1341085]

 
Come back to gene ENSMUSG00000055493


For any suggestions or comments, please send an email to unitrap@crg.es