Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_411F1-3
Clone ID CMHD-GT_411F1-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_411F1-3
Sequence
CTCCCACATCTCCCAACGGCCAGTGTTCTTGTCAGAGGAGCCCCCCTACTCCGCCCCGACTGCACTGCTTAATACCAGGA
GATTGCGGTGCCACCTCCGGTCCCACCACCACCGTCCAGCGAGGCCCTCAATGGCACGGTCCTGGACCCTTTAGATCAGT
GGCAGCCTAGTGGTTCCAGATACGCTCACCACCAGCCTCCGTCCCCACTGCCCGTGTACAGCTCCAGTGCTAAAAATTCC
AGTGCCTCCAACACCCAGGACGGCGTGGGCTCCCTTTGTTCCCGAGCAGGCGAGGAAGAGCACGTCTACCGCTTCCCCAA
CAAGCAGAAGTCAGCAGAGCCCTCACCTACCGTCATGAGCTCCTCCCTGGGCAGCAACCTCTCTGAACTTGACCGGCTGT
TACTGGAGCTGAACGCAGTGCAGCACAGCCCGCCTGGCTTCCCTGCAGATGAAGCCGAATCGAGCCCCCCCTTGCCTGGA
GCCCTGAGCCCCCTTTATGGCATCCC
Sequence Type mRNA
Unitrap ID UNI18140

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115994383..115995545 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029528 (Pxn) NM_011223 paxillin Gene [Source:MGI (curated);Acc:Pxn-001]

 
Come back to gene ENSMUSG00000029528


For any suggestions or comments, please send an email to unitrap@crg.es