Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_410E9-3
Clone ID CMHD-GT_410E9-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_410E9-3
Sequence
AGCCTGGGGTTCCAGTCAATAATTGCTACCTCATGTCTAAAGAAATCCCCTTTTCTG
Sequence Type mRNA
Unitrap ID UNI5045

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165654134..165654189 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 46531815..46531870 53
NO GENE  

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es