Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_411F8-3
Clone ID CMHD-GT_411F8-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_411F8-3
Sequence
TCTGCCTCCCTTCCTTCTGGCCCTTTTTGCACCCCAAGATCCCATCCCATACCTGCCACCCCTGGAAAAGCTGCCACATG
AAAAACACCATAACCAACCTTACTGTGGCATTGCACCATACATCCGAGAGTTTGAGGACCCTCGAGATGCTCCTCCTCCA
ACAAGAGCAGAAACCCGGGAAGAACGCATGAAGAAAAAGAAAAGAAAAAAAATTTTAACTGGCTTTTTCAGAAGAACATC
AAGAATAACAAGAGAGGTAAAGACGAATCTATAAAGTACTCTGCGTTGTTACCACTGC
Sequence Type mRNA
Unitrap ID UNI11845

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52647633..52650164 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063511 (Snrp70) NM_009224 U1 small nuclear ribonucleoprotein polypeptide A Gene [Source:MGI Symbol;Acc:MGI:98341]

 
Come back to gene ENSMUSG00000063511


For any suggestions or comments, please send an email to unitrap@crg.es