Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_409D1-3
Clone ID CMHD-GT_409D1-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_409D1-3
Sequence
AACAATTTTCCAAAGCGTTTAAGATCAACGAGCTGAAAGCCGAATTTGCAAATCACCTGGCCGTGCTGGAGAAACGGGTG
GAATTGGAAGGACTTAAAGTGGTGGAGATCG
Sequence Type mRNA
Unitrap ID UNI30347

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 31580779..31585338 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041119 (Pde9a) NM_008804 phosphodiesterase 9A Gene [Source:MGI Symbol;Acc:MGI:1277179]

 
Come back to gene ENSMUSG00000041119


For any suggestions or comments, please send an email to unitrap@crg.es