Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_402D1-3
Clone ID CMHD-GT_402D1-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_402D1-3
Sequence
GCAGCCTGCTTCTGCAAAGTGGTACGATCGAAGGGACTATGTATTCATTGAATTTTGTGTTGAAGACAGTAAAGATGTTA
ATGTAAACTTTGAAAAATCCAAACTTACTTTCAGTTGTCTTGGAGGAAGCGATAATTTTAAGCATTTAAATGAAATTGAT
CTTTTTCATTGTATCGATCCAAATGATTCCAAGCATAAAAGAACAGACAGATCGATTTTATGTTGTTTGC
Sequence Type mRNA
Unitrap ID UNI2259

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127505728..127507235 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071072 (Ptges3) NM_019766 prostaglandin E synthase 3 (cytosolic) Gene [Source:MGI (curated);Acc:Ptges3-001]

 
Come back to gene ENSMUSG00000071072


For any suggestions or comments, please send an email to unitrap@crg.es