Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_402H3-3
Clone ID CMHD-GT_402H3-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_402H3-3
Sequence
TGCTGCAGAGTTTCATCCATTACTGCTTGCTCTTCCTGGTTTACACGTTGATGCTGGCGTTTCAGTCAGGCAGTGATAAC
CTCCTGGAG
Sequence Type mRNA
Unitrap ID UNI29961

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 53645752..53645821 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042195 (Slc35f2) NM_028060 solute carrier family 35, member F2 Gene [Source:MGI Symbol;Acc:MGI:1919272]

 
Come back to gene ENSMUSG00000042195


For any suggestions or comments, please send an email to unitrap@crg.es