Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_410F8-3
Clone ID CMHD-GT_410F8-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_410F8-3
Sequence
TACGGAATGCTCCTGTACCAAAACTATCGCATCCCACAGAGGAAGGGTCTGCCCCCTCCTTTCAACGCACCTATGCGCAG
TGTTTCTGAGAATTCTCTTGTGGCCCTGGATTTTTCTGGACAAATCGAAAAAGTGATCGATAACCCGGCTGAAGCCCAGA
GTGCTGCCCTGGAAGAGGGCCATGCCTGGCGTAAGCGGAGCACACGGATGAATATCCTAAGCAGCCAAAGCCCACTGCAT
CCTTCTACCCTGAATGCAGTGATTCACAGGACTCAGCATTGGTTCCATGGACGTATCTCCCGCGAGGAGTCTCACAGGAT
CATCAAGCAACAAGGTCTCGTGGACGGGCTGTTCCTCCTTCGTGACAGCCAGAGTAATCCAAAGGCGTTCGTACTGACAC
TGTGCCATCACCAAAAAATAAAAAAATTCAAAATCTTACCTTGCGAGGATGATGGGCATACCTTCTTCACTCTGGATGAT
GGGAACACCAAGTTCTCCGATCTGATCCAGCTGGTCGACTTCTACCAGCTCAACAAAGGTGTTCTGCCCTGCAAGCTGAA
ACACCACTGCATCCGCGTGGCCTTATGACCTCCTTGCCCACTCACAGAGGCTGGAGGCAGCGACACTGGAACGGAGAAGA
GAGATCTGCATGAGGGTGAGAACACACACCTACTCCCACCCAAGGACTCAGAACAACATGGCTTTTTGATCGGTACCAAC
CGACCTACATCAATTAGTTATTGGACTTCACAAAGATTTGCCGCTGT
Sequence Type mRNA
Unitrap ID UNI29790

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11833287..11838487 324
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020176 (Grb10) NM_010345 growth factor receptor bound protein 10 Gene [Source:MGI (curated);Acc:Grb10-005]

 
Come back to gene ENSMUSG00000020176


For any suggestions or comments, please send an email to unitrap@crg.es