Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_404C5-3
Clone ID CMHD-GT_404C5-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_404C5-3
Sequence
GGGGAAGAGGTTCTGCTGGAACATTCGGGTGCTGATGCAACTGAAAGCTTTGAAGATGTCGGCCACTCCCCTGATGCCAG
GGAGATGCTAAAGCAGTACTACATTGGAGATGTCCATCCGAGTGACCTTAAACCTAAAGGCGATGACAAGGATCCTTCCA
AGAACAATTCATGCCAAAGTTCCTGGGCGTATTGGTTTGTCCCCATCGTGGGCGCTATTCTTATAGGTTTCTTGTATCGT
CACTTCTGGGCTGACAGCAAATCCTCCTGAGGAGACCTCGTTGAAGTGCGGAGCACGTGCTCCTGCGATGAGAGGAGGAG
ACTTGTGTGGAGGCTGCAGGGTGTTCCCTCCTTGGAACCTGCCAGTTGTTTTCTTTCCCCTTGGAGCCAAGATGGTTGAC
CAGATATCTATCCTCCTTCAAAGAACAACCAAAGTCTTTCATCCGCCAGAGCCTGGACGCCCAAAGCACCTGCTCACGCT
GTGTCCTTGTCAGGGTTTCTCTCATTGGTTCCCACTCCTTCCTTTCATTTCAAAAGTTGATGCCAATGACTTAGAGTTCC
TATGTTGTAGTGACATGGCCTTTGGGGACAGTACATGATTTCTCATAATTTGAATTCATAGTAGATATAGTTAAGGGAAC
AGCAGTCAGGTTATGAATCTTTTCCCATTTTTCTTTTTAAGTAAATTTATTTTTTTAATTCAG
Sequence Type mRNA
Unitrap ID UNI19893

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109693720..109707998 506
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031924 (Cyb5b) NM_025558 cytochrome b5 type B Gene [Source:MGI Symbol;Acc:MGI:1913677]

 
Come back to gene ENSMUSG00000031924


For any suggestions or comments, please send an email to unitrap@crg.es