Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_402D4-3
Clone ID CMHD-GT_402D4-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_402D4-3
Sequence
ACCCGGTGTGCCTGCTGGGCTGTGCCCAGGTTGAGAGCCATGCCAGTCTGTGGGTGAAGCCTGAGACAGTAATGGAGCCT
CTGCAGCAGCAGCAGCAGCAGCAGCAGCAGAAGCAGCCACAGCAGCCTCTGCTACAGATGGATGCCAGAGAGAAGCAGGG
ACCACAGACGAGAGAATCACAGTTCCTGTATGCCTCAAAACTAGGCACGCAGCCTGCTCTCCTTTCCATCACACCCGGGA
GACCTTCTGGTAGTTCTGTTCTGGGTCCCTTAGCCAGAGTTCCACCAGCCACACCGGTGGCTCGAATGTCTGAGCAGAGC
AACGTGAACTCCGAGCCTGAGGAGGAGGAAGGAGGCCTGGAAGATGAAGATGGAGATGATGATGTTGCAGAGGTGGCTGA
AAAAGAGGCCCAGGCTGCTTCCAAATATTTCCACATGCAAAAAGTACTCTGCGTTGTTACCACTGATT
Sequence Type mRNA
Unitrap ID UNI13584

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57681594..57682039 444
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004661 (Arid3b) NM_019689 AT rich interactive domain 3B (BRIGHT-like) Gene [Source:MGI Symbol;Acc:MGI:1930768]

 
Come back to gene ENSMUSG00000004661


For any suggestions or comments, please send an email to unitrap@crg.es