Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_403A1-3
Clone ID CMHD-GT_403A1-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_403A1-3
Sequence
GGGTGTAGAGTTTATTGATTCTCTCAGGAGCTGGTACCCAAAAGGCAGAAATTAAGAACTGTGCCAAGTGGTGCCCTATC
AACTCAAAATGTGTCAGTAACAGAAGCTGTGTCTGCAAGCCCGGCTTCAGCTCGGAAAAGGAATTGATCACTAACCCTGC
AGAGAGCTGTGAAGACATCGACTAGTGTTTACTACCTGGATTTTCCTGTGGAGACTTTGCCATGTGTAAAAACTCATAGG
GGAGTTATACCTGCGTCTGAAAGCTGGGATATAAACTCCTTTCTGGTGCATAATCTTTTGTTAACGAGAGTGAGAATACA
TGTCAAGATGTGAATGATTGCAACTCTGAGGCAACATCAATGTCACAATTCCACCGTCTGCAAAAACACCATAAGCTCCT
ACAAGTGCCACTGCCGTCCAGGTTGGAAGCCAACTTCTGGGTCCCTCCGTGGTCCAGACACCATATGCCAAGAGCCACCG
TTCCCTACTTGGACACTGCTGCCCACAGCCCACAGTCAGACTCTCTTGAGATTCTCTGTTGAAGTCCAGAATCTGGCTCC
GAGACTTCAATCCAGCCACGGTCAACTACACCATCCAGAAACTCATCGAGGCTGTGGACAAGCTGCTGGAAGACCCCATG
GAGACTCAAACCCAACAAGTACTCTGCGTTGT
Sequence Type mRNA
Unitrap ID UNI17741

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86252277..86258250 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002885 (Cd97) NM_011925 CD97 antigen Gene [Source:MGI (curated);Acc:Cd97-001]

 
Come back to gene ENSMUSG00000002885


For any suggestions or comments, please send an email to unitrap@crg.es