Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_408B11-3
Clone ID CMHD-GT_408B11-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_408B11-3
Sequence
GTGTTTAATGAACGCTGCCGAGTTCACTTCAAGCCTCCAAAGAATGAGTAGAGAGAGAGTTTTTTTAAGACTCGGTCATC
TCATCGCCTGGGCATGACAGATGTCAGCAGGGCCAGGTTCTGAGGGTGGTCTCTGAGCCAGCAGGCTGAGACCTTTGGTT
GGTTCAGCCCCATTCAGCCAAGACCTCAAGTCTAATTCTCATAATTATAAAATAATCAATTGCTATTTTATACTGATTCT
GTAAAAAATGTTTTGTAACTATTAAAATAATTTTCTG
Sequence Type mRNA
Unitrap ID UNI3994

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 36091920..36092196 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075229 (Ccdc58) NM_198645 coiled-coil domain containing 58 Gene [Source:MGI Symbol;Acc:MGI:2146423]

 
Come back to gene ENSMUSG00000075229


For any suggestions or comments, please send an email to unitrap@crg.es