Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_408E1-3
Clone ID CMHD-GT_408E1-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_408E1-3
Sequence
TGAGAGCATAACCACATACACCTTTAACACGCACAAAGCCCAGCACACCTTCTGCAAGAGATGTGGTGTCCAGAGCTTCT
ATACTCCGCGCTCCAACCCCGGGGGCTTTGGAATCGCCCCCCACTGCCTGGACGAAGGCACTGTGCGGAGTGTGGTCACT
GAGGAGTTCAATGGCAGTGACTGGGAACGAGCCATGAAGGAGCACAAGACCATCAAGAACATGTCAAAGGAGTGAGCAGG
GCAGTAGCCCTGTAGGTTGCATGGGTGTGTGTCGCTGTGCAGGCCTGCCTGGGCTACCATCTCCACTCCCCATGTCTCTG
AGGTTCACTCCAGCCACCATTTCTTTAGGCAGCTCTGCCTTAACCCAGGTTTCGTGTAAAAAACTTAACCTTCTCCCTTC
CTACCAATTTTTGTGTGATCTTTTAGAAAATAAATATTTCTGACATTAAAG
Sequence Type mRNA
Unitrap ID UNI14325

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62338451..62341103 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018509 (Prr6) proline-rich polypeptide 6 Gene [Source:MGI (curated);Acc:Prr6-001]

 
Come back to gene ENSMUSG00000018509


For any suggestions or comments, please send an email to unitrap@crg.es