Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_422A10-3
Clone ID CMHD-GT_422A10-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_422A10-3
Sequence
GCTGGGTCAGTGCATGTACGGATCCGACGAGATGCGAACGAACAAATGGTCCTTGCTCATGTGAGCAACAGGCTGTGCAC
GCTGGTGTCCACGCTGACTGTTCAGATCTTCAAGGACGACTGGATTCGGCCTGCCTTATCCTCTGGGCCTGTTGCGCCCA
ACGTCCTAAACTTCTCAGACCATCACGTAATCCCAATGCCTTTATTAAAGAACGTGGATGAGAGGACCCCCGTCACGTCA
ACCCCAACCAAGCCCAGCAGCCCACCTCCGGAGTTTTCATTTAATACGCCTGGGAAAAACGTGAGCCCGGTTATTCTTCT
GAACACACAGACAAGGCCATATGGTTTGGGTCTTAATCGCGGACACACACCATACAGCAGCGTGTTCAGCCAAGGACTCG
CATTTCCAGGAGTTGGAGCAGGCCAGGGATTGAGGCCCACCTTCCCACATATACCAAGTAGATATGGAATCAACAGGATG
GGGCAGCCAAGACCCTGACAGACTCTAACTTATTGTGATGGGGAATAGCGACTTCTTGCCTTCCAATGTATTTAGTAATC
CAACTTGCATTGACTGTTCAACCACTTACATGTCAGATTATTCCAGGCTTGTTCATATTTCATAAAACCTATAAACTATA
TTTTTG
Sequence Type mRNA
Unitrap ID UNI4277

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74822357..74823002 642
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024069 (Slc30a6) NM_144798 solute carrier family 30 (zinc transporter), member 6 Gene [Source:MGI Symbol;Acc:MGI:2386741]

 
Come back to gene ENSMUSG00000024069


For any suggestions or comments, please send an email to unitrap@crg.es