Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_427E12-3
Clone ID CMHD-GT_427E12-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_427E12-3
Sequence
GGAAACTGGATTCCAAGATCCATCAAGGAGCAAAGAAGGGGTTAATGAAGCAGAATAAAGCTGTCTGACCCAGG
Sequence Type mRNA
Unitrap ID UNI28671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65681182..65681255 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032386 (Trip4) NM_019797 thyroid hormone receptor interactor 4 Gene [Source:MGI (curated);Acc:Trip4-001]

 
Come back to gene ENSMUSG00000032386


For any suggestions or comments, please send an email to unitrap@crg.es