Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_424C4-3
Clone ID CMHD-GT_424C4-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_424C4-3
Sequence
TAAAAAGCTGGAGACGAAGCAGAAGCCGCCTGATGAGTGCACATGATGTGACGTCCACGCCAGACGGAGTTCTCGTTAGA
TTTTGGGTGAAAAGAAGCAGTATTTATTGACCTTAAAAATCTGAAGCAAACTTAGCTCT
Sequence Type mRNA
Unitrap ID UNI16148

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20798890..20799028 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019986 (Ahi1) NM_026203 Abelson helper integration site 1 Gene [Source:MGI Symbol;Acc:MGI:87971]

 
Come back to gene ENSMUSG00000019986


For any suggestions or comments, please send an email to unitrap@crg.es