Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_424C3-3
Clone ID CMHD-GT_424C3-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_424C3-3
Sequence
ATAGATGTCGATTTCCTATGGGAAGCAGGGTGGAGTCTCGCACCACCATTTCCCCAGTTCACCACCGGCCCAAGACCCGG
ACCAGTCCCAGACCTAATCCAGAGGCAGTGGCTATTGGCCACGTGGTTCGCGCAGTGGAGCACCCCACAGAAGACCTGGA
AAACCGTATCCCTGGTACCCCTGGGCCCTGGCTGGTGCCCAGCGAGGACCGGCTCTCGCGGGCTCTAGGGGTTCGGGGTG
GGGGCGCGCAGCTTGCTCTGGAGATGGCAGCCGGAAGGCGGAGGCATTGAGCACCAATAGACAGCTTTGTGCTCACTAGG
TGAGGTCCCATAAGGTTCTAGCATGCAGGACCGCCAGGCTCTAAGCTTTTCCCTTAGAGCTTTAACCTGGTTTAGTACCT
TCCCACTGCACATTGCACAGTGGAGTGGTCCCCACCCCTTCAAGACGCCAGTGGTATGGCCCTCCCAGAGCCCAGAGCGC
TCGCACCCCACCACCCCCACGTCCGCGTGGCGCGCAGCTTCTCCTAGTCCCTTCCCGACCGGGAGGTAATAAAATAGTTG
GATCC
Sequence Type mRNA
Unitrap ID UNI29306

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7251754..7252304 542
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031147 (Magix) NM_018832 MAGI family member, X-linked Gene [Source:MGI (curated);Acc:Magix-001]

 
Come back to gene ENSMUSG00000031147


For any suggestions or comments, please send an email to unitrap@crg.es