Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_423C6-3
Clone ID CMHD-GT_423C6-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_423C6-3
Sequence
GGATGAACTGTGAAAGCAACGTGAGCTTGACCAGTCTATAAACCGCAGTGGGCCGCTCCTCTCGGTCCTTACAGCATTTG
AGAACCAACAGCATCACAGCTTGTTTTGGACTTTGTTACACTCTTACTTTCAGCATGAAAACGTGTGGTTTTGTAGGATT
TCCTAATTCCAAACGGCGCGGAGCCAAACTGATAGAGGAAGGCTGCAGAGCGTTAACTGCGTGTGTTGTTTTAACATGCC
CACATTTCACTTTAAAAAAATATTAAAAAAAAGAGTTCTCCAACTG
Sequence Type mRNA
Unitrap ID UNI30371

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 7350489..7350774 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019795 (Pcmt1) NM_008786 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:97502]

 
Come back to gene ENSMUSG00000019795


For any suggestions or comments, please send an email to unitrap@crg.es