Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_417G9-3
Clone ID CMHD-GT_417G9-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_417G9-3
Sequence
GAACAACAAAGGACCACCTGGGAGTGGAAGATGCAGAAGACAAGTGTGAAAACATCATCACAATAGAAAATGGCATCCCT
TGTGATCCCTTGGACATGAAGGGAGGGCACATTAATGATGGCTTCTTGACAGAGGATGAGCGCCTCACCCCTCTCTGAGA
GTGACAGTCTTGTAAGAAAATTTTAAGATGCTTGAATGTGATTGACAACAAATTATATCCACAAAGACCAATGAAATCAT
AAGGTGTTAGCTTCTCAAAATATTCTAGAATTTTCTTTTTGATAACTGATTATGTAGGTATAGTGTGTGTTTGTAGTTAC
TGATTTGAGCATTTCTAGAAATAAAGTCAGGGCTGTAACTATATTTCATATTTTGAAGACCTAAGAAAAAAATTTTCACT
GGAGAATGGCTATAACATGGCATAGAAATCATTAAAAATGGATCTTTTTGAATACTGTTTATATTACTCTGTATATGATG
CATCGAGTAAAATTAAACAAGAGATGGATAAAAATGGCAAGGGAATTTTATTCTGTTATCACACCAACAGTTGCTTGTAT
AGTTTCTGCATATTAGTCTTTAGTAGGGCAAGCAGATCTATTTGTTGTTGCCTGCAATTTGTACACATCCTACCTATGCT
GATTTAATAAAGTAGTGATCATCTC
Sequence Type mRNA
Unitrap ID UNI30372

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 160556128..160556791 661
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015401 (Tmem27) NM_020626 transmembrane protein 27 Gene [Source:MGI (curated);Acc:Tmem27-001]

 
Come back to gene ENSMUSG00000015401


For any suggestions or comments, please send an email to unitrap@crg.es